crispr/cas9 genome engineering

Tools for genome editing and engineering, including CRISPR/Cas9 vectors, reagents, and gRNA design software.
The revolutionary NickaseNinja® allows for 2 tandem gRNAs on a single, All-in-One vector.

Ready-to-Use Genome Editing

With CRISPR/Cas9 technology you can direct precise modifications of complex genomes. Your gRNAs can be designed using ATUM’s design tool and cloned into ATUM Electra-CRISPR vectors.

Use CRISPR/Cas9 technology to:
• Insert gene(s) into specific locations
• Knockout expression of gene(s) in specific locations
E. coli, Yeast and Mammalian genomes
• Contact ATUM for development in your host species: +1 877 362 8646 or info@atum.bio

CRISPR/Cas9 Vectors are available with:

NickaseNinja
       2 tandem gRNAs on a single vector deliver increased transfection efficiency
Promoter Choice
       CMV, CBh, and CAG*
DS or SS Breaks
       Cas9 (S. pyogenes) causes double-strand breaks
       Cas9N nickase mutant causes single strand breaks (use 2 tandem gRNAs with NickaseNinja vector to further enhance specificity)
Expression Monitoring
        Choice of fluorescent reporters to monitor Cas9 expression


Process

 

CRISPR/Cas9 Genome Engineering Process

 

NickaseNinja constructs with dual gRNAs require the ATUM Custom Construct Service.
Using this service, any ATUM nickase vector can be designed and synthesized by ATUM to express your specific dual gRNAs as a NickaseNinja All-in-One vector.
NickaseNinja All-in-One vectors are NOT available as catalog items.
Catalog nickase vectors (ready-to-clone) allow Electra cloning of a single gRNA.

Cas9 nucleases are directed by a 20nt guide sequence to cleave almost any genomic locus. The resulting chromosomal break will normally be repaired via non-homologous end joining (NHEJ) producing small deletions or insertions at the targeted locus. Alternatively, by transfecting a homologous donor DNA with the Cas9, you can stimulate the homology-directed DNA repair system to replace the target sequence with a desired alteration.

Cas9 has two catalytic domains, the RuvC-like nuclease domain that cleaves the noncomplementary strand and the HNH nuclease domain that cleaves the complementary strand of DNA. Our Cas9N or nickase is a D10A point mutation in the RuvC-like nuclease domain of Cas9 nuclease.

The guide RNA directs Cas9 to the genomic target via Watson-Crick base pairing and can be easily programmed to target any genomic locus. ATUM’s gRNA design tool designs gRNAs with maximal specificity by minimizing sequence identity with other genomic loci outside your target.

*If you do not have a preferred promoter and you are using a different cell line from those we have tested (HeLa, HEK293, CHO and neuronal cells), we suggest you try all three.


Validation

The CRISPR vectors were validated by targeting the EMX-1 gene in HEK293 cells. The gRNA sequences were Electra cloned into the pD13xx vectors and transfected into HEK293 cells. Post-transfection, genomic DNA was isolated and sequenced at the appropriate locus. ATUM vectors displayed insertion and deletion (indel) frequencies which varied depending upon promoter sequence and displayed indel frequencies comparable to published data targeting the same locus.

Indel Frequency in HEK293 with Different Promoters Graph

gRNA sequences were Electra cloned into pD1301, pD1311, and pD1321. HEK293 cells were transfected using 0.5µg of plasmid. 72 hours post transfection, genomic DNA was isolated and sequenced. ATUM vectors displayed varying indel frequencies depending upon promoter sequence. Note: Indel frequency and promoter behaviour will vary in different cell types.

Notes

pD1300 and pD1400 Products (Research Use Only Products):
Any product containing pD1300, pD1400, pD2100, pD2500, pD2600, pD3500, or pD3600-series Vectors (the “Licensed Vectors”) (including Electra vectors, vector configurations for expression of multiple genes and other customized configurations of the Licensed Vectors, and ProteinPaintbox genes or CUSTOMER genes cloned into the Licensed Vectors) is subject to a limited, non-transferable license pursuant to which CUSTOMER acknowledges and agrees that the Licensed Vector may be used for internal research purposes only and may not be used for commercial purposes. For clarity, use for commercial purposes includes any use in manufacturing a product or service that is provided to a third party for consideration. In addition, CUSTOMER acknowledges and agrees that CUSTOMER and any Authorized Transferee (as defined in Section 11) may not (a) modify the Licensed Vectors in any way, including but not limited to replacing any protein-encoding sequence with any other protein-encoding sequence; (b) reverse-engineer, deconstruct, or disassemble the Licensed Vectors; (c) create any variant or derivative vector of the Licensed Vectors; or (d) transfer, disclose, or otherwise provide access to the Licensed Vectors (including sequences of same) to any third party other than an Authorized Transferee, and provided that any transfer to an Authorized Transferee must comply with the Product Transfer terms of Section 11.

Two Ways to Order:
Custom CRISPR Constructs (Transfection Ready) or
CRISPR Catalog Vectors (Ready to Clone)


Custom CRISPR Constructs (Transfection ready):

Let ATUM do the work for you. Simply, use our tool to design gRNAs to target your specific locus. ATUM will clone your gRNAs into the CRISPR construct of your choice and send you Ready-to-transfect plasmid. NickaseNinja vectors with 2 tandem gRNAs and increased transfection efficiency are only available with this service.
  1. Design your gRNA(s)
  2. Select your vector
  3. Order
CRISPR gRNA Design Tool

Cost: $300 (single gRNA vector), $600 (double gRNA NickaseNinja vector) for standard transfection ready prep (2-5 µg plasmid DNA). Endotoxin free midi preps (~100 µg plasmid DNA) are available for an additional $175.


CRISPR Catalog Vectors (Ready to Clone):

Select and order your vectors from the list below. Use our tool to design your gRNA, prepare and Electra-clone it yourself.

Vector Selector

All-in-One NickaseNinja®

2 tandem gRNAs on a single vector deliver increased transfection efficiency.

ATUM’s unique single nickase vector co-expresses two gRNAs using dual U6 promoters, thus removing the need for co-transfection. The NickaseNinja vector can also include a fluorescent reporter protein for easy visualization.

NickaseNinja constructs with dual gRNAs require the ATUM Custom Construct Service.
Using this service, any ATUM nickase vector can be modified by ATUM to a NickaseNinja All-in-One construct expressing your specific dual gRNAs.
NickaseNinja All-in-One vectors are NOT available as catalog items.

Ninjas_out_1

Features

  • High fidelity, minimal off-target effects
  • Convenient, single vector transformation
  • Tandem gRNAs for cloning into Nickase vector
  • 2A-linked reporter choice: DasherGFP, PaprikaRFP, none
  • Patent pending


Validation Data

NickaseNinja Indel Frequency
Comparison of the ATUM All-in-One NickaseNinja™ vector (using tandem gRNAs and dual U6 promoters) with the conventional 2-Vector system. gRNA sequences are as follows:
EMX1a: GGGCACAGATGAGAAACTC (63-81)
EMX1b: TGAAGGTGTGGTTCCAGAAC (100-119)
EMX1_1: AGTCCGAGCAGAAGAAGAA (166-184)
EMX1_9: CCGTTTGTACTTTGTCCTC (122-140)
See Cell (2013) reference below.

Vector Map



NickaseNinja_Vector_Map_02122014A

Design gRNA(s) to efficiently engineer your target and minimize off-target effects by using ATUM’s Scoring Algorithm.

The ATUM gRNA Design Tool enables:

  • Design gRNAs for wild-type or Nickase Cas9 vectors
  • Easy design of 2 tandem gRNAs for NickaseNinja vectors
  • Fast design against gene name, locus or specific target sequence
  • Suppression of off-target effects by avoiding sequences that match elsewhere in the genome
  • Direct ordering of your selected gRNAs in Electra CRISPR vectors, Transfection Ready

Enter your gene or sequence of interest and the design tool will identify all Cas9 target sites within the input sequence. The results contains a rank ordered list of target sites based on predicted specificity. The algorithm used in the program is based on the occurrence of the 12 base pair seed sequence preceding the NGG and NAG protospacer-adjacent motif (PAM).

CRISPR Design Tool screenshot

ATUM CRISPR gRNA Design Tool Screenshot. The design tool generates gRNAs in rank order coded by specificity to your target and allows you to visualize the position for your gRNA relative to the splice variants and any overlapping genes. It is routine in published literature to test more than one gRNA to maximize likelihood of success.

PCR your gRNA

To PCR your gRNA, we recommend you add the following ends to your primers, as these contain the Electra sites to clone directly into pDAUGHTER-CRISPR vectors.

  • Forward primer:
    5′-TACACGTACTTAGTCGCTGAAGCTCTTCTCCG….(gRNA)….-3′
  • Reverse primer:
    5′-AGGTACGAACTCGATTGACGGCTCTTCTAAC….(gRNA Reverse Complement)….-3′

You can either anneal your primers directly or design primers with 15-20 bp overlaps with the recommended ends and “anneal and extend”. We recommend 10 cycles of PCR. Use 1µl of PCR reaction in the Electra reaction shown below.

* Your gRNA must not contain any SapI recognition sites, since the Electra cloning process utilizes the typeIIs enzyme SapI.


Protocol

The DAUGHTER vectors are provided linearized with a 5’-CGG-3′ (bottom strand of figure above) and a 5’GTT-3´ overhang (top strand in figure above). Your gRNA (or PCR product) is mixed with the linearized pDAUGHTER-CRISPR vector in the presence of Electra reagent mix for 5 to 20 minutes at room temperature (25°C).

gRNA_Cloning_2


pD13xx_pD14xx_VectorMap_02132014

Component Volume (µl)
Total Volume 20
gRNA or Positive Control* (20ng) 1
DAUGHTER Vector (20ng) 1
Electra Buffer Mix* (1X) 2
Electra Enzyme Mix* (1X) 1
Sterile ddH2O 15
*Electra Cloning Kit reagents (Catalog #EKT-02).
  1. Combine components as listed in table above in a single 1.5ml tube. Note Daughter Vectors come pre-linearized from ATUM.
  2. Incubate 5 – 20 minutes at room temperature.
  3. Transform 2 µl of each reaction into competent cells.
  4. Plate onto LB plates with selection antibiotic
  5. Incubate overnight at 37°C. Pick transformants

Use CRISPR Cas9 to knockdown gene expression, via indel mutations, and to knock-in genes at precise locations in genomes of your choice.

We currently have developed products for mammalian and yeast systems. We have ongoing studies to develop CRISPR in E.coli and additional host systems, many through collaborations. We would love to work with you to develop CRISPR/Cas9 to work in your system. Please contact us at mammalian@atum.bio.

Yes, you can access our expertise to create a customized CRISPR vector, ideal for your specific host. Learn more about Custom CRISPR Vectors.

NickaseNinja is an all in one vector that expresses the nickase mutant of Cas9 along with 2 gRNAs that are necessary for the protein to function.

The NickaseNinja is currently only offered with our cloning services. We can clone your custom designed gRNAs into the vector for you.

Enter your gene or sequence of interest and the design tool will identify all Cas9 target sites within the input sequence. The results contain a rank ordered list of target sites based on predicted specificity. The algorithm used in the program is based on the occurrence of the 12 base pair seed sequence preceding the NGG and NAG protospacer-adjacent motif (PAM).

Indel frequency is a measure of the insertion and/or deletion rate of the target gene sequence. Indels are small insertions or deletions at the target site, presumably due to cutting by cas9/gRNA and then non-homologous end joining (NHEJ) in the host cell. NHEJ introduces small mutations (insertions or deletions, indels) that then escape cutting by Cas9/gRNA. After exposure to cas9/gRNA, we PCR out the region of interest for 12-24 individual colonies and sequence through the cut site. We then calculate the ratio of mutation or insertion/deletion at the cut site (indels) to unmodified wildtype sequence (wildtype) to get indel frequence = indels/wildtype*100 (as a percentage).

The most common is a 1bp deletion. We’ve seen 1-10bp deletions as well as small insertions. In the literature we see reports of between 1-10bp insertions and deletions.

Depends on the host. The maximum size of insertion in a particular host probably doesn’t change (it’s whatever is described in the literature for that host). CRISPR simply makes it more efficient, so you can do this without selection markers. You may be able to increase the maximum insert size slightly since the process is now more efficient, but you’ll have to experimentally validate this in your host.

CRISPR is so efficient that you don’t need selection. We usually pick 12-24 clones to propagate and screen by sequencing. Usually at least 1 in 10 will contain the appropriate frameshift mutation that results in a gene knockout. You can use antibiotic markers if you like, but CRISPR is so efficient that marker-less genome editing is common and usually the desired approach with CRISPR.

Consult a Design Expert

To determine the best possible option for your research project contact us at: +1 877 362 8646 or info@atum.bio.