Mammalian Expression Vectors

Achieve high levels of expression for your protein, with Gene Synthesis orders and from the ATUM Catalog.
Superior integration efficiency of >80% with Stable Leap-In Vectors.

 

VectorGPS Mammalian Elements Diagram



  Transient Stable (Leap-In™) Lentivirus
  pD600/pD2600 pD2500 pD2100
Cell Type Dividing Dividing Dividing and Non-Dividing
Expression Monitoring IRES or 2A with Fluorescent Proteins IRES or 2A with Fluorescent Proteins Limited (Size restrictions,IRES interferes with packaging)
Localization Monitoring N- or C-terminal Fusions, Fluorescent Proteins N- or C-terminal Fusions, Fluorescent Proteins  
Expression Marker None Antibiotics Antibiotics

Vector Selector

Overview

ATUM offers a large variety of expression vectors. Some vector properties are uniquely suited to different applications, and vector diversity is useful because proteins do not all behave in the same way. Our vectors are designed to maximize the chances that at least one will have the expression properties you need.

Expression levels are influenced by promoter, enhancer elements and introns; but total expression level does not necessarily correlate with the level of soluble, active protein. Proteins can be fused to affinity tags, localization signals, or fluorescent proteins.


Transient Vectors Show Range of Expression in Different Cell Types

DasherGFP Expression in Transiently Transfected HEK293 and CHO Cells

Mammalian Transient Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

Legend

Available (mouse over to see options) In my cart/favorites Email info@atum.bio formore information Labeled for comparison Error bar
DasherGFP expression in transiently transfected cells: HEK293 (adherent), Expi293™ (suspension), CHO-K1 (adherent), Freestyle™ CHO-S (suspension), ExpiCHO™ (suspension). Cells were transfected at 70-80% confluency using Lipofectamine 2000; transfections were carried out in duplicate and incubated for 72 hours post-transfection. Cells were lysed using M-PER and expression measured on a fluorimeter. Data points in yellow are shown for comparison.

Stable Vectors Also Show Good Transient Expression

DasherGFP Expression in Stably Transfected HEK293 and CHO Cells

Mammalian Stable Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

Legend

Available (mouse over to see options) In my cart/favorites Email info@atum.bio formore information Labeled for comparison Error bar
DasherGFP expression in stably transfected CHO cells and transient expression in HEK293 cells. Cells were transfected at 70-80% confluency using Lipofectamine 2000; transfections were carried out in triplicate in HEK293 cells and CHO cells. Selection media with 5 µg/ml Puromycin was added 72 hours post-transfection, grown for an additional 72 hours post-selection and media changed to complete growth media for a total of 14 days (2 passages in complete growth media) for CHO cells. DasherGFP transient expression was measured 72 hours post-transfection in HEK293 cells. Cells were lysed using M-PER and expression measured on a fluorimeter.

Stable Vectors with WPRE (license required)

DasherGFP Expression in Stably Transfected HEK293 and CHO Cells

Mammalian Stable Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

Legend

Available (mouse over to see options) In my cart/favorites Email info@atum.bio formore information Labeled for comparison Error bar

Recommended Vector Selection Process


Expression Vector
1. Single Expression Vector
Already know exactly which combination of elements you want? Use the Vector Selector on the order tab to choose one of our ready-to-use vectors.


Panel_Icon
2. Expression Panel
Not sure how your protein will behave? Test your gene in several vectors with a variety of properties most likely to increase expression. ATUM offers pre-selected Expression Panels, or you can create your own to explore the properties you think are most important.

VectorGPS_Icon_06032014
3. VectorGPS®
Want the very best vector for your system? ATUM will create unique combinations and configurations of vector components using our machine learning technology, to create a custom vector exactly suited to your needs. VectorGPS

Quick & Easy:

  • Ready-to-use linearized Electra™ daughter vectors allow you to clone your gene into multiple vectors in parallel
  • Explore the effects of copy number, enhancer, intron and promoter on protein expression in a single experiment
  • Test multiple localization signals, polyA and IRES/2A and their effect for your protein in your host cell
  • If you don’t find exactly what your protein needs, ATUM can help you explore deeper with VectorGPS
  •  

    CHO HEK Expression Variables

    Machine-learning algorithms identified vector components that contributed to expression of DasherGFP in HEK293 or CHO cells. Positive contributions have positive regression weights, the magnitude of the weight corresponds to the magnitude of the effect of the element.

Vector Selector

Different combinations of expression vector elements yield different protein expression levels. Vector behavior also depends on the expression cell line used. We have tested hundreds of combinations for their performance in HEK and CHO cells. You can select the best of these vectors from the interactive graph below. For other cell lines, we recommend a vector panel to determine the best performing vector for your system.

Transient Vector Performance Varies with Cell Type

DasherGFP Expression in Transiently Transfected HEK293 and CHO Cells



Mammalian Transient Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

Legend

Available (mouse over to see options) In my cart/favorites Email info@atum.bio formore information Labeled for comparison Error bar
DasherGFP expression in transiently transfected cells. HEK293 (adherent), Expi293™ (suspension), CHO-K1 (adherent), Freestyle™ CHO-S (suspension), and ExpiCHO™ (suspension) cells were transfected at 70-80% confluency using Lipofectamine 2000; transfections were carried out in triplicate and incubated for 72 hours post-transfection. Cells were lysed using M-PER and expression measured on a fluorimeter. Yellow data points are shown for comparison.

Antibody Expression from a Single Vector

Transient Vectors Show Range of Expression in HEK293 and CHO Cells

Mammalian Transient Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off
Antibody production in transiently transfected HEK293 and CHO cells. ATUM dual expression vector configurations (single construct) enable co-expression of antibody’s heavy and light chains by coupling expression through an IRES. Cells were transfected at 70-80% confluency using Fugene; transfections were carried out in triplicate in HEK293 and CHO cells. Antibody expression was measured by heavy chain quantitation by ELISA, 6 days post-transfection.

 

Comparison of Antibody Expression from Single Constructs

The balance of expression of an antibody’s heavy and light chains has a profound effect on antibody yield. The two chains can be co-expressed by coupling expression through an IRES, or by using a dual promoter configuration. Co-transfection of separate vectors carrying heavy and light chains is also feasible for transiently transfected cells, but is less desirable for stable cell line generation. Integrated copy number and integration position effects affect the balance of expression levels of the two chains, compromising the yield of properly assembled antibody. ATUM dual expression vector configurations outperform co-transfections of separate heavy and light chains.

Mammalian antibody expression data


Antibody production from transiently transfected HEK293 cells.
IRES elements in pD2610-v6 (green bars) or dual promoter configurations (red bars) were used to drive expression of both antibody chains from the same construct. Co-transfections of 3 ratios of heavy:light chain constructs (blue bars) are shown. Antibody was measured by ELISA from the media 6 days post-transfection.


Bicistronic Expression

Two or more proteins can be expressed from a single promoter using either IRES or 2A CHYSEL translational-coupling sequences. Constructs using translational coupling elements are often smaller and less repetitive than those which use a separate promoter for each protein. IRESes and CHYSEL elements have different properties that make them suitable for different applications.


IRES Elements


IRES_construct_04282015

IRES (Internal Ribosome Entry Site) elements create a second, cap-independent site for ribosomes to bind an mRNA molecule. This results in independent expression of two proteins from a single message. The ratio at which the two proteins are expressed depends on the efficiency of ribosome entry at the IRES compared with cap-dependent scanning from the 5′ end of the mRNA. Different IRESes provide different expression ratios of the 2 proteins (beige and blue arrows) and can be chosen based upon the ratio that is desired.

IRESes are particularly useful for antibody expression, where the optimal ratio between the chains for efficient assembly can differ for different antibodies. ATUM has developed a set of novel IRES elements, each produces a defined expression ratio between the first and second protein in every transfected cell. We can help you choose from these IRES elements to design and synthesize a custom bicistronic expression system with controlled protein expression ratios.

IRESes can also link expression of a protein to a selectable marker or fluorescent reporter expressed from a stably integrated vector, to indicate whether the construct is integrated at high copy numbers and in positions that are good for expression.

DasherGFP and CayenneRFP bicistronic expression compared in transiently transfected CHO and HEK293 cells.

Legend:
DasherGFP and CayenneRFP expression compared in transiently transfected CHO and HEK293 cells. IRES elements were tested in a GFP-IRES-RFP configuration in CHO (green circles) and HEK293 (red circles) cells. Cells were harvested for DasherGFP and CayenneRFP fluorescence measurements 72 hours post-transfection. The expression ratio was normalized using the ratio for sequences separated by a CHYSEL site. IRES efficiency is the ratio of RFP:GFP. An IRES can be selected to control the ratio of bicistronic expression between two proteins.

CHYSEL 2A Elements


CHYSEL_construct_04282015

CHYSEL 2A elements cause ribosomes to release the first protein while remaining bound to the mRNA and continuing translation. They therefore produce approximately equimolar amounts of the two (or more) proteins. Because ribosome binding occurs only at the start of the entire construct and reads through both ORFs, these are particularly useful for monitoring expression levels of a protein. Some ATUM vectors have a cloning site upstream or downstream of a gene encoding a fluorescent protein (green arrow), whose expression is directly proportional to the level of the other protein (beige arrow). CHYSEL elements add 18 amino acids to the C-terminus of the first protein, which can compromise the activity of some proteins. When used for antibody expression this can sometimes lead to formation of insoluble aggregates.




pD2600 Overview

ATUM has developed a new family of transient expression vectors by using VectorGPS™ to test combinations of vector elements for their performance in HEK and CHO cells. Many of these combinations yield higher expression than pCDNA3.4 or our first generation pJ600 series. There are several ways to access these vectors:

  1. Purchase any of these vectors as ready-to-use catalog items
  2. Get your gene synthesized and cloned into a vector. pD2600 vectors work reliably in both HEK and CHO cells.
  3. Test several vectors to see which works best in your cell line. Panels of Electra vectors are available for easy cloning and testing of your gene. Vectors with DasherGFP optimized for mammalian expression are also available to test expression.
  4. Perform VectorGPS™ to design and build the optimal vector for your protein and cell line.

pD2600_Vector_Map_20141120

Available Vector Elements: Use the Vector Selector to find your choice.

Enhancer Promoter Intron PolyA Amplification
CMV Chick Actin Chick Actin Beta Globin EBNA
EF1α CMV CMV A BGH OriP
SV40 EF1α CMV C HSV-TK SV40 T
Synthetic GAPDH EF1α SV40 early  
  HSV-TK Synthetic SV40 late  
  HTLV   Synthetic  
  MC1      
  PGK      
  SV40      
  Ubiquitin B      

Vector Cost

pJ600/pD600/pD2600 Vector Gene Synthesis Cost: Cloning of synthetic genes into these vectors is available free of charge. Regular gene synthesis fees apply.

Positive control vectors are available from ATUM’s catalog at half price if ordered with gene synthesis orders.

All vectors are also available in our catalog for cloning using the Electra® system.


pJ600s

ATUM′s pJ600 series of mammalian transient expression vectors are still available. These vectors use the strong CMV/IE enhancer/promoter and an SV40 replication origin to give high levels of protein expression in mammalian cells. Although most pJ600s have mammalian selectable markers, we recommend the Bifunctional Leap-In™ vectors for generating stable cell lines. pJ600 vectors are available with DasherGFP® as a positive control. Cloning into these vectors is performed at no additional cost for gene synthesis orders.

pJ60X-03 Vector Map

Features:

  • Protein expression levels equal to or higher than pCDNA3.1 vector when using the same insert.
  • Choice of low copy (pACYC) or high copy (pUC) bacterial origin.
  • Custom modified leader and open reading frame:
GGGGAAGCTGGCTAGCGCCGCCACCATG………TAAAAAA
                 Sample 5’UTR with Kozak                 ORF

 

Expression Images

Expression Vectors - pJexpress mammalian control Control Expression Vectors - pJexpress mammalian control microscope
Expression Vectors - pCDNA31 pCDNA3.1 Expression Vectors - pCDNA31 microscope
Expression Vectors - pJ603 pJexpress Mammalian pJexpress603 Expression Vectors - pJ603 mammalian microscope
Fluorescent protein expressed from pCDNA3.1 and pJ603 (Neomycin, pUC high copy origin expression vector) shows equivalent expression levels in pJ603 as measured by both FACS and immunofluorescence. (Images: Dr. Aaron Straight, Stanford University)

Notes

Important Info: Vectors used for Gene Synthesis orders do NOT contain the multiple cloning sites.

Restriction Sites: The pJ and pD vectors do not contain restriction sites for excision of your gene. Any restriction site desired can be added to your synthetic gene insert, and must be included in your gene design if you wish to remove your gene with restriction enzymes.

pD2600 Products (Research Use Only Products):
Any product containing pD1300, pD1400, pD2100, pD2500, pD2600, pD3500, or pD3600-series Vectors (the “Licensed Vectors”) (including Electra vectors, vector configurations for expression of multiple genes and other customized configurations of the Licensed Vectors, and ProteinPaintbox genes or CUSTOMER genes cloned into the Licensed Vectors) is subject to a limited, non-transferable license pursuant to which CUSTOMER acknowledges and agrees that the Licensed Vector may be used for internal research purposes only and may not be used for commercial purposes. For clarity, use for commercial purposes includes any use in manufacturing a product or service that is provided to a third party for consideration. In addition, CUSTOMER acknowledges and agrees that CUSTOMER and any Authorized Transferee (as defined in Section 11) may not (a) modify the Licensed Vectors in any way, including but not limited to replacing any protein-encoding sequence with any other protein-encoding sequence; (b) reverse-engineer, deconstruct, or disassemble the Licensed Vectors; (c) create any variant or derivative vector of the Licensed Vectors; or (d) transfer, disclose, or otherwise provide access to the Licensed Vectors (including sequences of same) to any third party other than an Authorized Transferee, and provided that any transfer to an Authorized Transferee must comply with the Product Transfer terms of Section 11.

Zeocin Concentration: Reduced zeocin concentration is indicated for selection with pJexpress 602 and 612 vectors in mammalian cells. 10-30 µg/mL zeocin has been shown successful, with slow but consistent resistant outgrowth noted.

pJ602, pJ603, pJ607, pJ608, pJ609, pJ612, pJ613, pJ617, pJ618, pJ619


References

View Publications using ATUM Mammalian Expression Vectors

Search the ATUM Literature Database, containing over 1,000 scientific publications using ATUM technology for references relevant to your research.


Vector Selector

Different combinations of expression vector elements yield different protein expression levels. Vector behavior also depends on the expression cell line used. We have tested hundreds of combinations for their performance in HEK and CHO cells. You can select the best of these vectors from the interactive graph below. For other cell lines, we recommend a vector panel to determine the best performing vector for your system.

Stable Vectors Also Show Good Transient Expression

DasherGFP Expression in Stably Transfected CHO Cells, Transient Expression in HEK293

Mammalian Stable Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

Legend

Available (mouse over to see options) In my cart/favorites Email info@atum.bio formore information Labeled for comparison Error bar
DasherGFP expression in stably transfected CHO cells and transient expression in HEK293 cells. Cells were transfected at 70-80% confluency using Lipofectamine 2000; transfections were carried out in triplicate in HEK293 cells and CHO cells. Selection media with 5 µg/ml Puromycin was added 72 hours post-transfection, grown for an additional 72 hours post-selection and media changed to complete growth media for a total of 14 days (2 passages in complete growth media) for CHO cells. DasherGFP transient expression was measured 72 hours post-transfection in HEK293 cells. Cells were lysed using M-PER and expression measured on a fluorimeter.

HPRE Outperforms WPRE

DasherGFP Expression in Stably Transfected CHO Cells

Mammalian Stable Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

DasherGFP expression in vectors with either the HPRE or WPRE enhancer elements in stably transfected CHO cells. Cells were transfected at 70-80% confluency using Lipofectamine 2000; transfections were carried out in triplicate. Selection media with 5 µg/ml Puromycin was added 72 hours post-transfection, grown for an additional 72 hours post-selection and media changed to complete growth media for a total of 14 days (2 passages in complete growth media). Cells were lysed using M-PER and expression measured on a fluorimeter.

Stable Vectors Also Show Good Transient Expression

DasherGFP Expression in Stably Transfected HEK293 and CHO Cells

Mammalian Stable Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

 

DasherGFP expression in stably transfected HEK293 and CHO cells using ATUMs new Stable expression vectors. 5×104 cells/well of HEK293 and CHO cells were transfected in triplicate. Cells were grown for 72 hours and split 1:10, 1:100 and 1:1000 into selection media with 2 µg/ml (HEK) or 16 µg/ml (CHO) Puromycin, 2 mg/ml (HEK) or 1 mg/ml (CHO) G418 for pJ603 control. Stable DasherGFP expression was measured on a flow cytometer, 10 days post-transfection (4 media changes).
Transient DasherGFP expression in HEK293 and CHO cells using ATUMs new Stable expression vectors. 5×104 cells/well of HEK293 and CHO cells were transfected in triplicate. DasherGFP fluorescence was measured on a flow cytometer 96 hours post-transfection.
Stable Expression Vectors with insulator elements are also available (pD2539 series) or purchase the entire panel EXP2520 with both pD2529 and pD2539 vectors. Additional promoters are also available.


Stable Vectors with WPRE (license required)

DasherGFP Expression in Stably Transfected HEK293 and CHO Cells

Mammalian Stable Vector Discount
BuyGet
2 10% off
3 20% off
4 or more 30% off

 

Legend

Available (mouse over to see options) In my cart/favorites Email info@atum.bio formore information Labeled for comparison Error bar
DasherGFP expression in stably transfected HEK293 and CHO cells. Cells were transfected at 70-80% confluency using Lipofectamine 2000; transfections were carried out in triplicate in HEK293 cells and in duplicate for CHO cells. Selection media with 5 µg/ml Puromycin was added 72 hours post-transfection, grown for an additional 72 hours post-selection and media changed to complete growth media for a total of 14 days (2 passages in complete growth media). Cells were lysed using M-PER and expression measured on a fluorimeter. Yellow data points are transient vectors shown for comparison.

Overview

The organization and orientation of functional elements in our new stable expression vectors promote efficient stable cell-line generation and high expression levels both before and after integration. These vectors are available with a choice of highly active promoters and mammalian selection markers.

pD2500_Vector_Map_20141120

Available Vector Elements: Use the Vector Selector to find your choice.

Enhancer Promoter Intron Expression Enhancer Mammalian Selection
CMV CMV Actin HPRE Blasticidin
Synthetic EF1α CMV WPRE Glutamine Synthetase
GAPDH EF1α AGS Hygromycin
HS4 Insulators Neomycin
Puromycin
Custom

Bicistronic Expression with IRES or 2A CHYSEL

Two or more proteins can be expressed from a single promoter using either IRES or 2A CHYSEL expression-linking sequences. We can help you choose from several available IRES elements to design and synthesize a custom bicistronic expression system with controlled protein expression ratios. For example, modulate antibody heavy and light chain expression levels in a single construct. Contact ATUM Ph.D. level customer support to assist with design.
Some ATUM vectors are already configured to monitor expression of your protein by linking it to one of our fluorescent proteins through an IRES or 2A CHYSEL sequence.

Feature IRES 2A CHYSEL
Bicistronic Expression Yes Yes
Single Vector and Promoter Yes Yes
Protein Expression Non-equimolar levels of proteins before and after IRES Constant ratio (approximately equimolar levels) of proteins flanking the 2A site
Size Large, >500 base pairs Small, 18-22 amino acids, easy to incorporate
Protein Modification Some IRESes have short N-terminus additions 18 aa at the C-terminus of the first ORF,
“P” at the N-terminus of the second ORF.
Silencing Silencing effects Less susceptible to silencing
Learn more about how IRES and 2A CHYSEL bicistronic expression works: IRES and 2A CHYSEL Overview

Vector Cost

pD252x (HPRE) Vector Gene Synthesis Cost: Cloning of synthetic genes into these vectors is available free of charge. Regular gene synthesis fees apply.

Positive control vectors expressing DasherGFP are available from ATUM’s catalog at half price if ordered with gene synthesis orders.

All vectors are also available in our catalog for cloning using the Electra® system.


Notes

Important Info: Vectors used for Gene Synthesis orders do NOT contain the multiple cloning sites.

Restriction Sites: The pD vectors do not contain restriction sites for excision of your gene. Any restriction site desired can be added to your synthetic gene insert, and must be included in your gene design if you wish to remove your gene with restriction enzymes.

pD2500, pD3500, pD3600 Products (Research Use Only Products):
Any product containing pD1300, pD1400, pD2100, pD2500, pD2600, pD3500, or pD3600-series Vectors (the “Licensed Vectors”) (including Electra vectors, vector configurations for expression of multiple genes and other customized configurations of the Licensed Vectors, and ProteinPaintbox genes or CUSTOMER genes cloned into the Licensed Vectors) is subject to a limited, non-transferable license pursuant to which CUSTOMER acknowledges and agrees that the Licensed Vector may be used for internal research purposes only and may not be used for commercial purposes. For clarity, use for commercial purposes includes any use in manufacturing a product or service that is provided to a third party for consideration. In addition, CUSTOMER acknowledges and agrees that CUSTOMER and any Authorized Transferee (as defined in Section 11) may not (a) modify the Licensed Vectors in any way, including but not limited to replacing any protein-encoding sequence with any other protein-encoding sequence; (b) reverse-engineer, deconstruct, or disassemble the Licensed Vectors; (c) create any variant or derivative vector of the Licensed Vectors; or (d) transfer, disclose, or otherwise provide access to the Licensed Vectors (including sequences of same) to any third party other than an Authorized Transferee, and provided that any transfer to an Authorized Transferee must comply with the Product Transfer terms of Section 11.


References

View Publications using ATUM Mammalian Expression Vectors

Search the ATUM Literature Database, containing over 1,000 scientific publications using ATUM technology for references relevant to your research.


Vector Selector

Overview

ATUM’s new series of lentiviral expression vectors (pD2100s) deliver efficient integration and high expression with HPRE and AGS elements.
Lentiviral expression vectors integrate a defined region of plasmid vector into a target cell line. They are available with DasherGFP as a positive control. Lentiviral vectors infect both dividing and non-dividing cells, producing homogenous levels of transgene expression across a population of cells. Available for gene synthesis orders, and as ready-to-use catalog vectors.

Lentivirus vector map pD2100


Available Vector Elements: Use the Vector Selector to find your choice.

Enhancer Promoter Expression Enhancer Mammalian Selection
CMV CMV AGS Puromycin
EF1α HPRE

Expression

Lentivirus_Expression_102014
Expression of DasherGFP (pD2109-CMV-03) in 293T/17 cells 48 hours post-transfection . 293T/17 cells were transfected with pD2109-CMV plus 3rd generation lentivirus packaging plasmids using standard transfection reagents. ATUM lentiviral vectors are compatible with both the second and third generation packaging plasmids.

Vector Cost

Lentivirus Vector Gene Synthesis Cost: Cloning of synthetic genes into these vectors is available free of charge. Regular gene synthesis fees apply.

Positive control vectors are available from ATUM’s catalog at half price if ordered with gene synthesis orders.

All vectors are also available in our catalog for cloning using the Electra® system.


Lentiviral Packaging

ATUM does not supply packaging plasmids or cell lines, however ATUM Lenti vectors are compatible with both 2nd and 3rd generation lentiviral packaging systems. Minimally, plasmids encoding HIV-1 Gag, Pol, Rev and envelope (VSV-G is recommended) are necessary for co-transfection with Lenti vector for proper formation of infectious viral particles. HEK293 or a derivative (293T, etc.) cell line are recommended to allow for high efficiency simultaneous transfection of 3-4 plasmids.

See datasheet for an example of a protocol that has been effective for 2nd generation packaging systems.


Notes

Important Info: Vectors used for Gene Synthesis orders do NOT contain the multiple cloning sites.

Restriction Sites: The pD vectors do not contain restriction sites for excision of your gene. Any restriction site desired can be added to your synthetic gene insert, and must be included in your gene design if you wish to remove your gene with restriction enzymes.

pD2100 Products (Research Use Only Products):
Any product containing pD1300, pD1400, pD2100, pD2500, pD2600, pD3500, or pD3600-series Vectors (the “Licensed Vectors”) (including Electra vectors, vector configurations for expression of multiple genes and other customized configurations of the Licensed Vectors, and ProteinPaintbox genes or CUSTOMER genes cloned into the Licensed Vectors) is subject to a limited, non-transferable license pursuant to which CUSTOMER acknowledges and agrees that the Licensed Vector may be used for internal research purposes only and may not be used for commercial purposes. For clarity, use for commercial purposes includes any use in manufacturing a product or service that is provided to a third party for consideration. In addition, CUSTOMER acknowledges and agrees that CUSTOMER and any Authorized Transferee (as defined in Section 11) may not (a) modify the Licensed Vectors in any way, including but not limited to replacing any protein-encoding sequence with any other protein-encoding sequence; (b) reverse-engineer, deconstruct, or disassemble the Licensed Vectors; (c) create any variant or derivative vector of the Licensed Vectors; or (d) transfer, disclose, or otherwise provide access to the Licensed Vectors (including sequences of same) to any third party other than an Authorized Transferee, and provided that any transfer to an Authorized Transferee must comply with the Product Transfer terms of Section 11.


Vector Selector

Let ATUM Increase Your Expression

Consult with an Expression Specialist today at +1 877 362 8646 or info@atum.bio to achieve your research goals quickly and affordably.