CRISPR Vectors

SPEED

ATUM’s unique single nickase vector co-expresses two gRNAs using dual promoters, thus removing the need for co-transfection. Vectors are available with a fluorescent reporter for easy identification of transfected cells.

SPECIFICITY

Use two tandem gRNAs with a NickaseNinja vector with Cas9N nickase mutant to enhance specificity.

PRECISION

gRNA design tool to design gRNAs to target your specific locus. ATUM will clone your gRNAs into the CRISPR construct of your choice and send you ready-to-transfect plasmid.

CRISPR Vectors

CRISPR Vectors Overview

ATUM’s CRISPR vectors comprise a gene encoding the Cas9 nuclease, and a cassette for expressing the guide RNA which targets the nuclease.

Cas9 nucleases are directed by a 20nt guide sequence to cleave almost any genomic locus. The resulting chromosomal break will normally be repaired via non-homologous end joining (NHEJ) producing small deletions or insertions at the targeted locus. Alternatively, by transfecting a homologous donor DNA with the Cas9, you can stimulate the homology-directed DNA repair system to replace the target sequence with a desired alteration.

Cas9 has two catalytic domains, the RuvC-like nuclease domain that cleaves the noncomplementary strand and the HNH nuclease domain that cleaves the complementary strand of DNA. Our Cas9N or nickase is a D10A point mutation in the RuvC-like nuclease domain of Cas9 nuclease.

The guide RNA directs Cas9 to the genomic target via Watson-Crick base pairing and can be easily programmed to target any genomic locus. ATUM’s gRNA design tool designs gRNAs with maximal specificity by minimizing sequence identity with other genomic loci outside your target.

ATUM’s mammalian CRISPR vectors offer the following feature choices:

gRNA sequences were Electra cloned into pD1301, pD1311, and pD1321. HEK293 cells were transfected using 0.5µg of plasmid. Genomic DNA was isolated and sequenced 72 hours post transfection.  ATUM vectors displayed varying indel frequencies depending upon promoter sequence. Indel frequency and promoter behavior will vary in different cell types.

The CRISPR vectors were validated by targeting the EMX-1 gene in HEK293 cells. The gRNA sequences were Electra cloned into the pD13xx vectors and transfected into HEK293 cells. Post-transfection, genomic DNA was isolated and sequenced at the appropriate locus. ATUM vectors displayed insertion and deletion (indel) frequencies which varied depending upon promoter sequence and displayed indel frequencies comparable to published data targeting the same locus.

DS or SS Breaks:

  • Cas9 (S. pyogenes) causes double-strand breaks
  • Cas9N nickase mutant causes single strand breaks (use 2 tandem gRNAs with NickaseNinja vector to further enhance specificity)

ATUM’s unique single nickase vector co-expresses two gRNAs using dual U6 promoters, thus removing the need for co-transfection. The NickaseNinja vector can also include a fluorescent reporter protein for easy identification of transfected cells.

NickaseNinja constructs with dual gRNAs require the ATUM Custom Construct Service. Using this service, any ATUM nickase vector can be modified by ATUM to a NickaseNinja All-in-One construct expressing your specific dual gRNAs.

Expression Monitoring:

Choice of fluorescent reporters to monitor Cas9 expression, or linked puromycin resistance

Custom CRISPR Constructs and CRISPR Catalog Vectors are not for use in humans.

Validation Data

Comparison of the ATUM All-in-One NickaseNinjaâ„¢ vector (using tandem gRNAs and dual U6 promoters) with the conventional 2-Vector system. gRNA sequences are as follows:

EMX1a: GGGCACAGATGAGAAACTC (63-81)

EMX1b: TGAAGGTGTGGTTCCAGAAC (100-119)

EMX1_1: AGTCCGAGCAGAAGAAGAA (166-184)

EMX1_9: CCGTTTGTACTTTGTCCTC (122-140)

See Cell (2013) reference.

Custom CRISPR Constructs and CRISPR Catalog Vectors are not for use in humans.

Two Ways to Order:

Custom CRISPR Constructs (Transfection ready):

Let ATUM do the work for you. Simply, use our tool to design gRNAs to target your specific locus. ATUM will clone your gRNAs into the CRISPR construct of your choice and send you Ready-to-transfect plasmid. NickaseNinja vectors with 2 tandem gRNAs and increased transfection efficiency are only available with this service.

  1. Design your gRNA(s)
  2. Select your vector
  3. Order

Cost: $300 (single gRNA vector), $600 (double gRNA NickaseNinja vector) for standard transfection ready prep (2-5 µg plasmid DNA). Endotoxin free midi preps (~100 µg plasmid DNA) are available for an additional $175.

CRISPR Catalog Vectors (Ready to Clone):

Select and order your vectors from the list. Use our tool to design your gRNA, prepare and Electra-clone it yourself.

Custom CRISPR Constructs and CRISPR Catalog Vectors are not for use in humans.

Share

Search